That is very correct. I know at least several cases about collecting specimens that should have never happened - one would think that researchers should be the ones with common sense. Alas, not always.
4 Likes
And let us not forget that there are many non-English speaking countries, where people will create common names in their languages. And in the cases of smaller countries and less widely spoken languages, there will be virtually no problem at all - common public or even naturalists will never even need common names for some small or/and less known species well outside the range of the country or the area.
2 Likes
This is fair enough. Though shouldnât it then be the responsibility of those countries to then develop localized names? I imagine Latin and Greek terms mean just as little as English in many other languages. We have some names like âtricolorâ which you can at least translate or work out thanks to English or maybe French, Spanish, Italian at times. But in Asian countries there must be very little use there.
And as it happens, I find that countries like Japan actually have some of the most comprehensive âcommon nameâ coverage of any non-English country I know.
2 Likes
Oh, I can say for Lithuania. We have frightening language rules for the creation of âofficialâ common names. The Language Board prefers not to use person names (which are in Latin), unless the species name is very much settled and was used before. Descriptive names are used, but they are not always correct for a species in its whole range: for example, it may prefer forests in its whole area, but only swampy forests in Lithuania. Or there may be more species in the genus with a selected character for a common name, but they do not occur in Lithuania and it is unlikely that Lithuanian name will be ever needed for them.
4 Likes
The issue is that in many (most?) countries that I have dealt with, you have to speak English if you want to be accepted in scientific circles. Much of higher education is in English rather than the native languages and scientific work is expected to be conducted and published primarily in English. As a result, not only are most native-language speakers in the country faced with an additional major barrier to pursuing scientific work, but nearly all of the persons with scientific knowledge who are responsible for bridging this knowledge to the public are doing it from an English basis. So they end up either taking directly from the published scientific name or taking from the English name.
I certainly would want scientists to take the forefront of popularizing appropriate local names, but it doesnât happen easily.
4 Likes
The issue with the âwhoever follows the rules must be rightâ dogma is that the rules simply donât do very much. Recently this has resulted in a lot of taxonomic vandalism along with the issues mentioned in this thread.
https://www.smithsonianmag.com/science-nature/the-big-ugly-problem-heart-of-taxonomy-180964629/
https://blogs.scientificamerican.com/tetrapod-zoology/taxonomic-vandalism-and-hoser/
(Disclosure - Iâve personally been cited by Hoser in some of his horrific publications. Though it usually feels nice to be cited, his citations of my work were totally inappropriate and unscientific, bearing no relation to the actual claims being published.)
Itâs appeared pretty clear that we need new rules in taxonomy. But not everything has to be rules either. Isnât there a middle ground where we can encourage others to follow better practices without needing to make explicit regulation to legislate it?
7 Likes
Iâve seen the pseudo-taxonomy produced by Hoser for many reptiles and itâs pretty terrible. Itâs one of the more egregious examples of self-serving naming of organisms. Thankfully, his nomenclature apparently lacks standing and need not be referenced since it doesnât meet the basic requirements under ICZN rules for publication and recognition.
I feel like this is the most realistic suggestion offered so far. There are obviously questionable situations involving species named after people, but it also seems clear to me from the discussion that itâs unrealistic to not have any, especially in large under-researched genera.
I wonder if thereâs a difference in perspective here between people who specialize in vertebrates and people who specialize in invertebrates/plants/fungi, since vertebrates are generally larger and fewer in number and thus have easier to identify distinguishing features and ecological differences (and are more thoroughly researched).
7 Likes
There might be. It seems that many vertebrate species that are being recognized as ânewâ nowadays are actually previously described taxa that were sunk into synonymy long ago and then the name was resurrected based on new genetic evidence. Certainly not all, as we see in the Vietnamese snake examples mentioned above, but quite a few, especially in North America.
Added for clarification: Many vertebrates in North America were perhaps over-described as species starting in the 1800s, based on morphology â the many scientific names for Grizzly Bear is one example â and were later lumped together. Some of the names survived through the 1900s as subspecies, others disappeared from use. With the advent of genetic techniques, a lot of these âdeadâ names were dusted off and put to use again. So it seems there have been fewer brand new taxa described for recently recognized (or re-recognized) species. So the history of vertebrate taxonomy is probably rather different than for other less-studied organisms.
3 Likes
Some cryptic species are only confidently differentiated genetically. A descriptive name then would be something like Crypticgenus attgagattacatgggtacctagatc - including a genetic sequence. Or we could try shortening it to Crypticgenus gattaca but that could turn out to be a very common sequence :D
6 Likes
I am sorry, but you are contradicting yourself somewhat (compare your response to @silversea_starsong. First thing, Bad taxonomy (same as bad research) has existed and will probably not cease to exist, regretfully. There are examples in all branches of natural sciences. This has nothing to do with principles of naming or honorific names. But, if every researcher will publish only in their native language, the situation will become even worse, because peer-reviews will not be possible. Peer-reviews are one of the stronger barriers for bad science. It is not almighty, but still. I can give you an example: I had to review a paper (in English) where a new species was described. Author was non-English, of not very widely spoken language. The description was nonsensical, because the author did not notice a small but important character by which two genera are separated. So, he was describing a species which was already known, but belonged to a different genus. What would have happened, if he submitted the paper in his native language - there are no researchers who know this group of fungi and can speak or even understand the language of the author. Hence, common scientific language must exist. As it is not Latin any more, English has replaced it.
4 Likes
I can tell youâre attacking me by how you address me but I honestly canât see what claim of mine that youâre disagreeing with.
Unfortunately the situation is not as clear as you suggest - the ICZN has frequently accepted Hoserâs names, as this article I already linked point out. And even in the cases where his naming has now been officially disputed, it was on grounds that he easily could have remedied if he had simply done slightly more work in the paper and shelled out a bit of cash to get it published in a predatory journal rather than his own self-published disaster, yet the work wouldnât have been any more valid.
https://www.smithsonianmag.com/science-nature/the-big-ugly-problem-heart-of-taxonomy-180964629/
Friends of mine have had to devote significant time and resources to fighting the Hoser mess - that simply wouldnât be the case if the rules were clearly against him and easily enforced.
2 Likes
While I can see your point that there may be differences in ease of naming vertebrates vs. invertebrates/plants/fungi, from what Iâve seen thereâs no difference in the actual naming - the issues we are talking about are just as prevalent in recently-named vertebrates as they are in other classes. That suggests to me that the root issue isnât ease.
This argument has already been addressed overâŚand overâŚand over in this thread. A characteristic need not be âconfidently differentiatingâ in order to be notable, it just has to be notable, and all organisms on Earth have dozens of notable characteristics. Beyond this, range, habitat, microhabitat, habits, etc. can also be used.
I am sorry, if you see argumentation or jokes as a personal attack. But not to heat the things up, I am stopping this discussion here.
5 Likes
You called me out and accused me of contradicting myself but didnât tell me what the contradiction was or what I had said that you disagreed with. Since nothing you argued goes against anything I said, I have no way of knowing what you are referring to.
And there werenât any jokes in your comment, so why are you bringing up jokes again?
Folks, note that you can reply to more than one person in a post by using Quotes, and also please let others have a chance to contribute to the conversation. Iâve just activated slow mode and no one can make consecutive posts without waiting 15 minutes.
6 Likes
Thereâs no way I can wade through the 139 posts to contribute my one thought, but I didnât see anyone mention it when I skimmed through. Forgive me if itâs a redundant point:
As Iâve been learning species names, the best names are those with specific diagnostic information. God bless whomever named the Willow Pine Cone Gall Midge. Those five nouns just say it all, and when you see one, itâs really easy to Google. Honorifics have always been, well, unhelpful, from a diagnostic perspective. Nuttallâs Violet just doesnât do anything for me.
However, history is important. (Even histories you think are misappropriated, misprioritized, or immoral.) The one big benefit of honorifics is not that it glorifies dead dudes, but that it storifies them. I might not ask who Nuttall is, or Say, or Tweedy, or Suksdorf, unless I encounter them in an honorific. And learning a biography is a way of living another lifetime within your own.
We are an ahistorical, amnesiac culture. The tendency of the Enlightenment is to prioritize the subjectâs present experience over the telling of anotherâs. This has yielded a lot of good, but at the cost of the many benefits of history and tradition. This is the best reason I can think of to retain honorifics.
But, I still prefer descriptive names, because God bless anyone who can make taxonomy any easier.
12 Likes
Well, that opens a whole other can of worms, as the expression goes. In my earlier example of Wilsonia, it turns out that the hooded warbler should actually be in the genus Setophaga, and the other two species, in the genus Cardellina. But as Wikipedia notes:
âThis change has been accepted by the North American Classification Committee of the AOU and the IOC, however the South American Classification Committee of the AOU continues to keep Wilsonia in use.â
So we then ask: which continent gets to dictate what names everyone in the world must use?
If the above changes to Wilsonia are accepted, then Wilsonâs warbler becomes Cardellina pusilla, and thus its scientific name makes no reference at all to Wilson. The same is true of Wilsonâs snipe (Gallinago delicata), Wilsonâs storm petrel (Oceanites oceanicus), and Wilsonâs phalarope (Phalaropus tricolor).
1 Like